, 2011). Conversely, WFDC1 ( Figures 6E–6H) was expressed most strongly in frontal cortical areas (e.g., DLPFC) and lowest in caudal V1, with expression primarily restricted to L2. Many genes showed area-selective expression (Figures 6I–6L). NEFH, an intermediate filament heavy

chain subunit generally expressed in long range projection neurons, was selectively enriched in L5 of M1 where the longest, spinally projecting neurons, Betz INK 128 concentration cells, are located. Other genes were selectively enriched in specific regions of frontal cortex, including ACG (CALML4, IGFBP5, and LXN) or DLPFC and OFC (CD53). ISH showed selective enrichment of IGFBP5 in ACG compared to DLPFC and OFC ( Figure 6K). Conversely, ISH analysis of CD53 ( Figure 6L) showed enrichment in dorsolateral, ventrolateral, and ventromedial cortex Selleck Forskolin relative to dorsomedial cortex and ACG. The laminar and areal patterning observed in macaque was then compared to homologous structures in human and mouse. This phylogenetic comparison is shown in Figure 7, made possible by the availability of mouse and human ISH data in the Allen Mouse Brain Atlas (http://mouse.brain-map.org) and Allen Human Brain Atlas (http://human.brain-map.org) generated using the same ISH technology platform as the macaque data. Some macaque data was also derived

from the NIH Blueprint Non-Human Primate Atlas (www.blueprintnhpatlas.org). Most genes in Figure 4 above showed laminar expression patterns that were highly conserved between macaque and human, with lesser conservation in mouse. Laminar patterns were generally conserved between primates and mice in visual cortex for CUX2, RORB,

RXFP1, and COL24A1 (left panels in Figure 7), although RXFP1 in mouse showed some regional differences between visual and somatosensory cortices not apparent in the macaque ( Figure 7C). Other genes with highly laminar patterns showed major differences between species, indicated by blue arrowheads in Figures 7E–7G. PDYN either ( Figure 7E) was enriched in excitatory neurons in L4 and L5 in rhesus and human, but in neurons with a broader laminar distribution that colabel with GAD1 indicating expression in GABAergic interneurons in mice (data not shown). The synaptic vesicle protein SV2C was predominantly enriched in superficial L3 pyramidal neurons in most cortical areas in primates (e.g., V2), while it is fairly selective for deep L5 pyramidal neurons in mice. NR4A2 was expressed selectively in deep L5 and L6 in macaque and human, and in both L6 and L2/3 in mice ( Figure 7H). While laminar distributions between V1 and V2 were highly conserved between macaque and human, differences were also noted. PDYN was expressed in L4B in macaque V1 in addition to the dominant L4Cb/5 expression ( Figure 7E), while in human only L4Cb/5 expression was observed.

The PPL1 cluster contains five distinct DAN types with stereotyped innervation zones within the MB lobes, the neuropil housing the axon fibers of MB intrinsic neurons (Mao and Davis, 2009). DAN output has been shown to be necessary for the acquisition

of aversive olfactory memories (Schwaerzel et al., 2003), and artificial stimulation of the PPL1 DANs in the presence of an odor is sufficient to form aversive olfactory memory (Claridge-Chang et al., 2009). These studies provide evidence that the PPL1 DANs convey the unconditioned stimulus (US) to the MBs, where it converges with the olfactory conditioned stimulus (CS) for the acquisition of aversive olfactory memories. Two distinct dopamine receptors, dDA1 and DAMB, are highly expressed within the MB intrinsic neurons and are coupled to the cAMP signaling pathway, and thus are likely mediators of dopaminergic effects on olfactory memory (Sugamori

et al., 1995, Han et al., 1996 and Kim Erlotinib mouse et al., 2003). Indeed, the dDA1 receptor is required for both aversive and appetitive olfactory memory formation in adult flies (Kim et al., 2007). While the DAMB receptor mutant was reported to produce aversive olfactory memory defects in larvae (Selcho et al., 2009), these results were confounded by odor preference defects and leave the role of DAMB in adult olfactory learning and memory largely unknown. Here we utilize bidirectional modulation of DAN activity Ixazomib with temporal precision, in vivo

functional imaging of DAN activity, and dopamine receptor mutant analysis to address the role that dopamine plays in memory. Our results indicate that dopamine has a dual role in both the acquisition of olfactory memories and the forgetting of these memories. We used the GAL4 > UAS system (Brand and Perrimon, 1993) to acutely modulate the activity of Drosophila’s DANs during the period of memory retention after olfactory classical conditioning. Oxygenase Our initial studies employed a tyrosine-hydroxylase (TH) gal4 line (TH-gal4) to drive UAS-transgene expression in the DANs in the fly brain ( Mao and Davis, 2009 and Friggi-Grelin et al., 2003). We drove expression of a UAS-shits1 transgene encoding a temperature-sensitive Dynamin protein that blocks synaptic output at restrictive temperatures ( Kitamoto, 2001) or a UAS-trpA1 transgene encoding a temperature-sensitive cation channel to stimulate DANs at elevated temperatures ( Hamada et al., 2008). Both of these transgenes provide for normal neuronal function below 25°C but modulate activity at temperatures above 29°C. Thus, these two tools allow for the control of neuronal activity in a bidirectional way. Remarkably, we discovered that blocking synaptic output from DANs with UAS-shits1 for 40 min or more after learning significantly enhanced memory measured at 3 hr ( Figure 1A), whereas there was no significant increase in memory with control +/UAS-shits1 flies.

01) and resulted in a significant improvement of spatial learning (Figures 5C–5E, n = 16 mice/group, p < 0.01) and social interactions in both adult (Figures 5F and 5G, n = 16 mice/group, p < 0.01) and juvenile (Figure 5H, n = 18 mice/group, p < 0.01) EPAC−/− mice. Thus, LTP and the behavioral deficits observed in EPAC AT13387 ic50 null alleles

can be reversed by knockdown of miR-124. We next investigated whether expression of miR-124 mimics the effects of EPAC null mutation. We constructed type ½ recombinant adeno-associated virus (rAAV1/2) vectors to express miR-124 (rAAV1/2-miR-124, Figure 6A). As a control, a negative miRNA sequence (GTGTAACACGTCTATACGCCCA, rAAV1/2-control, or control) was expressed. We found that expression of miR-124 in the hippocampus of EPAC+/+ mice reduced Ferroptosis mutation the endogenous Zif268 to a level similar to that observed in EPAC−/− mice (Figures 6B and 6C, n = 4, p < 0.01). When miR-124 was expressed in the hippocampus of EPAC−/− mice, however, there was no further decrease of Zif268 (Figure 6C, n = 4, p < 0.01), indicating that EPAC null mutation occludes the inhibitory effects of miR-124 on Zif268 translation. This inhibition was specific since expression of miR-124 had no effect on several other genes (Figure 6B, n = 6, p < 0.01), including cyclic AMP-response element binding protein (CREB) and brain-derived

growth factor (BDNF). Importantly, we found that expression of miR-124 did not alter the basal synaptic transmission (Figures 6D and 6E, n = 12 recordings/6 mice/group), but it resulted in a loss of a late phase of LTP (Figures 6F and 6G, n = 15 recordings/5 mice/group, p < 0.01) and disrupted the spatial learning and memory (Figures 6H–6K, n = 15 mice per group, ∗p < 0.01). Notably, however, the social behaviors were normal when miR-124 was expressed in the hippocampus (Figures 6L–6N, n = 15 mice per group). It has been known that the social behaviors are largely processed in the prefrontal cortex of the

brain (Walsh et al., 2008 and Silverman et al., 2010). We thus expressed miR-124 in this region by injection of the rAAV1/2-miR-124/eGFP virus particles and found it did cause the social behavioral deficits (Figures 6L–6N, n = 15 mice per group). Significantly, miR-124 phenotypes including the deficits of LTP (Figure 6G, n = 12 recordings/6 mice/group, p < Tryptophan synthase 0.01), spatial learning (Figures 6H–6K, n = 15 mice per groups), and social behaviors (Figures 6L–6N, n = 15 mice per groups) can be reproduced by knockdown of endogenous Zif268 using LNA-Zif268 antisense (Figure S3, n = 13 mice per groups). Together, these results demonstrate that miR-124 transcription mediates the EPAC effects in regulation of LTP, spatial learning, and social interactions by controlling Zif268 translation. EPAC proteins activate Rap1 guanine nucleotide exchange factor (de Rooij et al., 1998, Kawasaki et al., 1998 and Zhang et al.

All counts were performed blinded to the genotype of the animals. Golgi impregnated neurons were visualized in brightfield with a 40× objective and traced using Neurolucida software (MBF Bioscience). Neuronal tracings were subjected to Sholl analysis using Neuroexplorer software. The center of all concentric circles is defined as the center of the soma. The starting radius was 12.5 μm, and the click here ending radius was 200 μm from the center with an interval of 12.5 μm between radii. Mice were perfused with 4% PFA and postfixed overnight and vibratome sectioned at 70–100 μm. Sections were permeabilized and

blocked for 2 hr in PBS plus 0.1% Triton X-100, 10% serum, 0.2% gelatin. Sections were incubated 48 hr in primary antibodies: chicken anti-GFP (1:500, Aves Labs), rabbit anti-GABA (1:2,000, Sigma A2052,), rat anti-CTIP2 (1:500, Abcam ab18465), rabbit anti-SATB2 (1:1,000, Abcam ab34735), mouse anti-NeuN (1:500, Millipore MAB377), rabbit anti-RFP (1:500, MBL PM005), Protease Inhibitor Library solubility dmso and rabbit

anti-Shh (1:200, a kind gift from S. Scales, Genentech). Images were acquired using a Leica SP5 laser scanning confocal microscope. For synaptophysin-GFP puncta counts images were analyzed using Imaris (Bitplane). Only axon segments with a minimum length of 20 μm and a least one GFP puncta were included in the analysis. All counts were performed blind to the treatment. Corticospinal projections were retrogradely labeled with red fluorescent microspheres (Lumafluor) injected into the spinal cord at the C2–C3 level at P21–P28. Callosal projections were labeled by injecting fluorgold (Fluorochrome, LLC) into the contralateral sensorimotor cortex. Brains were collected for isothipendyl processing 24–48 hr after injections. Mutant mice and their wild-type littermates ages

P21–P28 were anesthetized with Avertin and decapitated. Brains were quickly dissected in ice-cold “sucrose-ACSF” buffer containing 252 mM sucrose, 126 mM NaCL, 3 mM KCl, 1.25 mM NaH2PO4, 2 mM MgSO4, 26 mM NaHCO3, and 10 mM D-glucose. Brains were vibratome sectioned in the same solution at 300 μm and transferred to ACSF without sucrose. Slices were recovered at 35°C for 30 min and then maintained at room temperature. Neurons were targeted for whole-cell patch clamp recording with borosilicate glass electrodes having a resistance of 2–6 MΩ. The electrode internal solutions was composed of 130 mM potassium gluconate, 10 mM KCl, 10 mM HEPES, 1 mM MgCl2, 16 mM sucrose, 5 mM EGTA, 4 mM Na2ATP, and 1 mM NaGTP, titrated to pH 7.3 with KOH for recording mEPSCs. Channelrhodopsin recordings were done with an internal solution composed of (in mM) 120 CsMeSO3, 15 CsCl, 8 NaCl, 0.5 EGTA, 10 HEPES, 5 QX-314, 10 TEA-Cl, 2 Mg-ATP, 0.3 Na-GTP; pH adjusted to 7.3 with CsOH, 290 mOsm. During collection of miniature EPSCs external solution was supplemented with 1 μM tetrodotoxin and 10 μM bicuculline.